Well, when you're refuting an inaccurate version of the theoryIts not a theory. A theory is a well tested set of observations with vast explanatory and predictive power.
He has a whole lot of predictions, a few of which have already been confirmed. He also has explanations that make quite a lot of sense. Sounds like a theory to me.
That's perfectly fine and I appreciate you asking them, but you shouldn't expect me to just say "Oh wow, you're right, my bad." when you're not dealing with the theory properly, at least not as far as I can see.Then try "hey, this is the part you missed" and link to a page, because I'm not reading the entire book again. Its VERY hard to tell where I'm not following the rails of his crazy train and where he's not following reality.
I'll try, but I don't always have the time. I did quote a bit of a relevant portion of the radioactivity chapter for you though.
As to it not happening on Jupiter, first of all it's not pressure from an ocean alone that he says did it. Second of all, I don't imagine Jupiter has enough quartz for it to have happened there.Electric voltages of about 10 million volts, and currents of 10 million amps Р a hundred times greater than the most powerful lightning bolts Р are required to explain the X-ray observations. These voltages would also explain the radio emission from energetic electrons observed near Jupiter by the Ulysses spacecraft.
According to the theory, radioactivity began by the piezoelectric effect in quartz in the crust during the flood. I don't remember Jupiter having quartz, so I don't see how mentioning Jupiter is relevant.
Also, the math on the generation of voltage seems to be ignoring that a 27% quartz structure won't get nearly the voltage he needs because the quarts is all spread out. Most of the electricity would be resisted by the rock.
I'll find a "real science link" to this, but the voltages in the granite during the flood exceeded granite's breakdown voltage, causing "lightning" in the granite.
Its already been done in a laboratoryCan you give me a real science link to it?
Here's one. If I link you to something on the site, will you be able to check the references that go along with it? Most of his claims have some references and they're conveniently linked for his readers.
Essentially, a global flood affected everything in the world very similarly. The same mechanisms affecting pretty much the same environment for the same amount of time would cause this.This isn't an answer.
Why did it consistantly act in such a way that the stuff further down appears, when you carbon date it, to be older than the stuff above it?
I'll have to look into that.Its a real problem because biology, chemistry, geology and physics are all giving the same answer. All you have is a lot of unsupported suppositions.
All I really have time to do is link you to his page on radiocarbon dating
Pillars made out of graniteLike i said, thats not going to work. Granite gets soft and plastic under that much pressure if its as hot as it is down there. The continent is going to get wobbly: you basically have a record spinning around on a warm marshmellow.
I suppose the pillars were thick enough to support it, but according to the theory most of the weight from the granite was supported by the subterranean water itself.
Also, something i should add here: the moon. You've got essentially a hollow earth with a near infinite amount of pressure exerted outward from a 1,000 degree source of pent up water.. and then you're going to have that planet stretched and pulled by our abnormally large moon spinning around it, and it doesn't crack in even one spot?
Yes, tidal pumping was a major influence leading up to the flood, as he said it was (scroll down to "Three Common Questions". And it did crack in one spot, that's how the flood started according to the theory.
I don't know. My guess is that you and him disagree on what large means. He should have been more clear though.-You mean the great salt lake should be producing salt deposits larger than the great salt lake?
Large salt deposits are not being laid down today, even in the Great Salt Lake.
Apparently he doesn't consider the Great Salt Lake as an example of a large salt deposit. He's likely thinking on a bigger scale here.
Seems clear to me.This doesn’t contain an explanation. If you had random sinking and rising with earths quakes the mammoth and triceratops skulls should still wind up in the same spots together. Triceratops skulls should be close to mammoth skulls and archaeopteryx skulls should be near raccoon skulls.
Instead what we see is that the relative ages of the fossils match evolution, not density. The hypothesis runs utterly concurrent to our observations.
According to his theory the fossils weren't sorted according to density alone:
How did it happen? During the early days and weeks of the flood, flutter amplitudes were large enough for the crust to rise slowly out of the flood waters. [See “Water Hammers and Flutter Produced Gigantic Waves” on page 180.] Frightened animals—and sometimes dinosaurs—scampered uphill onto the rising land, each leaving footprints. Minutes later, the crust again submerged, allowing sediments falling through the thick muddy waters to blanket and protect the prints while the rising water swept the animals’ bodies away. Other perishable prints—called trace fossils—were made in the same way. [See item 9 on page 184.]
Each time the crust fluttered up above the muddy flood waters, it had (in evolutionary terms) “thousands of years” worth of additional layered sediments containing sorted dead things trapped in liquefaction lenses. The approximate order of burial, from the bottom up, were sea-bottom creatures, then animals and plants that were first overcome, ripped up, and deposited by the initial flood waters, then the larger animals that could float and live for some period of time (such as many dinosaurs), then mobile animals that could flee to high ground. Each region had its own mix of animals and plants. Once they were buried in sediments, liquefaction provided additional sorting by such characteristics as density. Sometimes, dinosaur prints from the previous upward flutter minutes earlier were sandwiched between layers that never experienced liquefaction again.
But when fusion creates elements that are heavier than iron, it requires an excess of neutrons. Therefore, astronomers assume that heavier atoms are minted in supernova explosions, where there is a ready supply of neutrons, although the specifics of how this happens are unknown. [See Eric Haseltine, “The Greatest Unanswered Questions of Physics,” Discover, February 2002, p. 40.]So an article 10 years ago didn’t know the specifics, but had a general outline for it happening. But because we only have a general outline we need to assume that the physics are wrong and that the bible is right….
I'll grant you that saying that we don't have a scientific answer doesn't mean that we can't find one.
No. Dear gods... no. Rational science based on observable evidence has beaten theology at every turn. If you don't want to loose your religion entirely learn some humility and accept that you can interpret the bible incorrectly.
I very much have to deal with issues of pride and considering myself more intelligent than most people that I know (at least in real life), so I won't deny that it can be an issue. Yes, there's a possibility that I have misinterpreted the Bible, even though I could go into quite a lot of detail as to why I interpret it as I do. Do you think it is more prideful for me to stick to my position than for other people to stick to theirs? I'm curious as to your opinion because I don't want to be or come across as prideful.
I could fill a few quite large posts with nothing but quotes from scientists listing problems with current scientific theories. Maybe they don't explain things so well after all.No, you couldn’t. You could do some more disingenuous quote mining like you have there where someone tells you that when they age a 200 million year old rock they might be off by a couple million years.
Kirth already called you out on that behavior.
I'll grant you that answers can often be found when there aren't any yet, and that some quotes express ignorance about exact mechanisms without undermining the principles behind them. However, there are still some very very large gaps between theoretical and practical understanding of many things that naturalism claims to explain (DNA once again comes to mind. Even IF (big if there) it could have formed from RNA, where did the information come from? Not to mention the origin of the universe itself.). How big does a gap have to be for an alternative solution to be considered?
What molten lava?So the core of the earth used to be solid?
Yes. Check out the section on Trenches and Plate Tectonics if you have time.
Ok you lost me here.This is hard without a picture.
You have superheated, minieral rich water shooting out of the earths crust over a small area. It would be like taking a pressure washer to a rock: you make a smooth, strait line in the side. That isn’t there at the trench… or anywhere for that matter.
It wasn't a small area. It was the entirety of the Mid-Atlantic and Mid-Oceanic Ridges. It sounds like you're describing a huge cliff leftover from the subterranean chamber. That isn't predicted by the theory and wouldn't even make sense to be an effect from it.
Contributor, RPG Superstar 2010 Top 8
|
According to his theory the fossils weren't sorted according to density alone:
How did it happen? During the early days and weeks of the flood, flutter amplitudes were large enough for the crust to rise slowly out of the flood waters. [See “Water Hammers and Flutter Produced Gigantic Waves” on page 180.] Frightened animals—and sometimes dinosaurs—scampered uphill onto the rising land, each leaving footprints. Minutes later, the crust again submerged, allowing sediments falling through the thick muddy waters to blanket and protect the prints while the rising water swept the animals’ bodies away. Other perishable prints—called trace fossils—were made in the same way. [See item 9 on page 184.]Each time the crust fluttered up above the muddy flood waters, it had (in evolutionary terms) “thousands of years” worth of additional layered sediments containing sorted dead things trapped in liquefaction lenses. The approximate order of burial, from the bottom up, were sea-bottom creatures, then animals and plants that were first overcome, ripped up, and deposited by the initial flood waters, then the larger animals that could float and live for some period of time (such as many dinosaurs), then mobile animals that could flee to high ground. Each region had its own mix of animals and plants. Once they were buried in sediments, liquefaction provided additional sorting by such characteristics as density. Sometimes, dinosaur prints from the previous upward flutter minutes earlier were sandwiched between layers that never experienced liquefaction again
But that doesn't work as an explanation either. There were a lot of different kinds of dinosaurs, so they should have sorted themselves out by behavior along with the birds and mammals and whatnot (with the 'large' dinosaurs succumbing first, and then the 'mobile' dinosaurs climbing up to the high ground). Instead, we have all the dinosaurs together in the lower strata.
There were also a fair number of slow, lumbering mammals that shouldn't have been able to survive until the later stages of the flood, but somehow did. Giant sloths for example. Yet we always find giant sloths in the upper strata.
And what about creatures that can swim or fly? We'd expect all of them to end up together in the same strata, since they all possess a similar ability to survive the flood. Instead we find modern birds up at the top, and ancient flying creatures like pteranodons down at the bottom. Why did they sort like this?
That doesn't even get in to plants. Plants wouldn't have been able to flee the flood, and so they should have laid down fossils in a completely random manner, or be sorted by density. Instead we've got a clear evolutionary progression from top to bottom.
Hydroplating and it's proponents have so far failed to adequately explain how marine life survived this event. A very large portion of marine life are stenohaline, this means they can only survive in narrow range of salinity.
Now, freshwater can sit on top of salt water, but it mixes very easily, pretty much any motion would mix the two. The motion described in hydroplating is fairly violent, the waters would mix. Even without motion, they would mix within days, a short enough time that any stenohaline species right now would die.
Hydroplating is a young earth theory. It necessarily excludes evolution (and hyrdoplating theorists also claim macro-evolution does not exist). If this is true, the majority of marine species would be euryhaline, able to survive in more than one salinity range. Also, not even all euryhaline are able to survive broad salinity ranges, they just change environments at some point during their life (like being born/breeding in freshwater than moving to salt water once mature).
Not only is the salinity important, but the type of salts as well. Not all salt is the same, certain kinds of salt will kill marine life.
When Mt. St. Helens erupted lakes most affected were unable to support plankton for two years, it still took another 8 years after that for them to really start to look like they did before the eruption. After that the lake started to repopulate from fish reproduction in neighboring areas, but during the hydroplating event, there were no neighboring areas.
Hydroplating either would have killed the majority of sea life, or only highly adaptable species would have remained, those that can survive wide ranges of salinity, temperature and turbidity. There was no where where they could have hid to survive this calamity, they had to survive it right in the middle of all this chaos under the water.
He has a whole lot of predictions, a few of which have already been confirmed. He also has explanations that make quite a lot of sense. Sounds like a theory to me.
A theory has never been demonstrated wrong, even once. Hydroplate has too many things make no sense or are completely wrong, and its "predictions" only describe known events. At the top of the list is deposition.
You do not need any fancy radiometric dating to figure out the RELATIVE ages of fossils. Older stuff goes at the bottom. We know this because of how sedimentary rocks are formed, a process we can directly observe at every stage today. If you want to say this is circular, you'll have to say HOW its circular.
With a world wide flood you should have rocks and fossils going bottom to top from biggest to smallest. Mastodon skulls should be right next to triceratops skulls: they are not. Sedimentary rocks should go from congolmerates up to fine clays: they do not.
You can see an orderly progression through time. This was the case even before we understood evolution: the thing that was causing the progression. How is it that science and geology independently arrived at the same answer. Physics came along later and added more confirmation. Why are these three different branches of science all giving us the same answer?
The explanation offered, that the dinosaurs are down below because they were clumsier and less able to avoid the incomming flood, quite frankly sucks. There's no reason that an archeopterix, Procompsognathus, or pteranadon would be less able to avoid the flood than a mammoth. There's no reason that the flood should be more deadly to a blue whale than a pleisiasaur.
Even if it were true, it could only be true as a statistic. You would expect to find ONE giant ant eater at least that was slow or lame and couldn't get away any faster than the brontosaurus. (patty is a girls name)
There's really no excuse for buying this explanation. He can hide all of his other obfuscation behind confusing technobabble and graphs, but seriously, "The pteranadon couldn't fly out of the way but the mammoth could run away" doesn't require a degree in anything to see through.
According to the theory, radioactivity began by the piezoelectric effect in quartz in the crust during the flood. I don't remember Jupiter having quartz, so I don't see how mentioning Jupiter is relevant.
The piezoelectric effect only causes the electricity. It doesn't directly do anything to the atoms: so as long as you have the electricity you should, if that guy is right, be tossing off atoms left and right.; The thing is that jupiter generates that level of electricity all the time in lightning storms.
You seem to be confusing the source of the electricity (piezoelectric effect) with any demonstrable effect on the atoms. That's pinching (z pinching or theta pinching) that does that, which isn't dependant on having quartz nearby.
He's also using the numbers of the granite as if it were 27% of quartz because it is 27% quartz.. it doesn't work like that.
If I link you to something on the site, will you be able to check the references that go along with it? Most of his claims have some references and they're conveniently linked for his readers.
What your creationist is further overlooking is that our best machine, which uses far, far more electricity per unit of area than he's talking about, can only make the fusion of Deutirium (heavy hydrogen) easier. We can't do it with anything heavier... not even hydrogen.
http://en.wikipedia.org/wiki/Z_machine
There's no way this effect made uranium without destroying the planet.
Do you think it is more prideful for me to stick to my position than for other people to stick to theirs?
In this case yes, because your position is glaringly and obviously wrong. Physics, biology, paleontology, geology, astronomy, archeology, zoology and anatomy are ALL telling you you're wrong and you're insisting that you're right based on half baked excuses parading around as explanations.
The geocentrists had their reasons for reading the bible the way they did too.
I think I see the point that you are trying to make, but again you chose a terrible example. Ignaz Semmelweis' discovery had nothing to do with Leviticus. He noticed that the babies birthed by midwives had a far lower mortality rate from what we now know as infection than those birthed by doctors, since as it turned out, doctors did not wash their hands between autopsying bodies and birthing babies. He used observation to come to his conclusions and not relying on coincidence. In any case he said nothing about running v. still water; instead he advocated washing with a weak bleach solution instead of not washing at all.Until the mid 19th century, conditions in hospitals were not very sanitary at all. Dr. Ignaz Semmelweis saw that the doctors didn't wash their hands after handling the recently deceased patients. After they started washing their hands in running water (instead of a bowl) the mortality rate for delivering mothers dropped from about 30% to about 2%. Lev. 15:13 says to wash in running water to get rid of uncleanness.
I'm not saying that the writer of the Bible at that time knew WHY they were inspired to write those things, but what matters is that the Bible was right.
Yes, I know. That's why I put it in the general "they were right" category, rather than "this discovery was made because of this" category that I put ocean currents in. I gave the specific example there because I knew of it. I should have been more clear though.
The fact that the Bible gets the occasional fact about nature correct does not mean that you can start making up theories to support your preconceived notions, which is what hydroplate theory is. IT begins with the idea that the biblical notion of the flood is correct and then tries to contort various scientific principles to "prove" it. That is exactly the opposite of how scientific thinking works, as I and many other commenters have noted.
As far as I can see modern scientific thinking begins with denying the Biblical notion of the flood and then tries to contort various scientific principles to "prove" it. Everyone has assumptions and biases. Do you think that creationists have confirmation bias, but naturalists are somehow immune?
On the subject of poling, the external refrences that I found say that it can only happen within a crystalline domain and not between multiple crystalline domains. By symmetry, I mean essentially the shape of the crystal., not the arrangement of the individual small crystals in the quartz.
I'll need to take a look at that. Do you have links for your references?
Unfortunately, I don't always have time to read the original source.nategar05, you strike me as an earnest and intelligent fellow, so it pains me to see you being misled by someone whose arguments are fundamentally dishonest. The truth of God's creation should stand on its own merits, from your own studies -- that's why God gave you the gift of reason. No one should have to sell you an intentionally incorrect interpretation of it.
Thank you for the compliment in the first line. There are too many assumptions out there about atheists choosing to be evil and religious people being too dumb to know about science that are simply not fair.
I glanced at the paper and I'll take a more thorough look when I have the chance. How do you feel it's out of context? Do you think that Walt misrepresented the writer or the theory? Both?
The Bible says to circumcise infant sons on the 8th day. It was recently discovered that the platelet count of a newborn peaks on the 8th day. Imagine how many lives were lost because of bloodletting, when Lev. 17:11 says "For the life of the flesh is in the blood." That could have all been prevented by taking what the Bible has to say seriously.Your conclusion, then, is that no one was capable of making observations or inferences until post-Biblical times? That God gave us the gift of reason only within the last 3,400 years? Because it would seem obvious to me, were I a rabbi, to observe what day of circumcision gives the best results, and then record that result in my instruction book. I don't even need to know about platelets -- I only need to watch and see that the wounds bleed more profusely if I don't wait at least that long.
Likewise, the prohibition against shellfish in Leviticus could easily be a response to the observed effects of a toxic algal bloom, or high concentrations of heavy metals in the local sediments, or whatever. Anyone who isn't an idiot will eventually figure out that the people who ate the oysters got sick, and prohibit shellfish in general -- at least until the cause could be understood. This knowledge doesn't have to be divinely imputed; it could easily be gained by direct observation.
I'll grant you that that makes sense. I suppose that would render those examples rather "neutral" when it comes to this conversation.
A benevolent God will allow His creations to figure these things out for themselves, rather than having to tell them specifically which animals are "an abomination unto Him." That's why He gave us eyes, and brains, and memories, and the ability to learn writing so that we could record our observations and thoughts.
Well, I'd think a benevolent God would warn us in the first place so that we didn't have to wait for people to die from food poisoning, for instance.
| 1 person marked this as a favorite. |
I glanced at the paper and I'll take a more thorough look when I have the chance. How do you feel it's out of context? Do you think that Walt misrepresented the writer or the theory? Both?
Both -- von Huene's paper improved our view of subducting plates, not as rigid slabs like car hoods, but as the sliding masses of rock and sediment they actually are. He wasn't in any way saying that subduction doesn't occur -- rather, he was showing how a more robust view of it matches the observations better than the clumsy model tentatively being used -- and how it may be deeper than originally suspected. For Walt to take a quote that, in essence, says, "look -- subduction fits what we see really well, as long as we're careful about keeping track of what's really happening and don't try to oversimplify it" and to claim it's saying "subduction is false" is a gross misrepresentation of the worst kind, because it can't be attributed to ignorance on Walt's part -- it's outright lying. I always sort of felt that if there's a Truth(TM), the truth (opposite of lying) ought to lead to it, not be put in opposition to it.
According to his theory the fossils weren't sorted according to density alone:
How did it happen? During the early days and weeks of the flood, flutter amplitudes were large enough for the crust to rise slowly out of the flood waters. [See “Water Hammers and Flutter Produced Gigantic Waves” on page 180.] Frightened animals—and sometimes dinosaurs—scampered uphill onto the rising land, each leaving footprints. Minutes later, the crust again submerged, allowing sediments falling through the thick muddy waters to blanket and protect the prints while the rising water swept the animals’ bodies away. Other perishable prints—called trace fossils—were made in the same way. [See item 9 on page 184.]Each time the crust fluttered up above the muddy flood waters, it had (in evolutionary terms) “thousands of years” worth of additional layered sediments containing sorted dead things trapped in liquefaction lenses. The approximate order of burial, from the bottom up, were sea-bottom creatures, then animals and plants that were first overcome, ripped up, and deposited by the initial flood waters, then the larger animals that could float and live for some period of time (such as many dinosaurs), then mobile animals that could flee to high ground. Each region had its own mix of animals and plants. Once they were buried in sediments, liquefaction provided additional sorting by such characteristics as density. Sometimes, dinosaur prints from the previous upward flutter minutes earlier were sandwiched between layers that never experienced liquefaction again
But that doesn't work as an explanation either. There were a lot of different kinds of dinosaurs, so they should have sorted themselves out by behavior along with the birds and mammals and whatnot (with the 'large' dinosaurs succumbing first, and then the 'mobile' dinosaurs climbing up to the high ground). Instead, we have all the dinosaurs together in the lower strata.
There were also a fair number of slow, lumbering mammals that shouldn't have been able to survive until the later stages of the flood, but somehow did. Giant sloths for example. Yet we always find giant sloths in the upper strata.
And what about creatures that can swim or fly? We'd expect all of them to end up together in the same strata, since they all possess a similar ability to survive the flood. Instead we find modern birds up at the top, and ancient flying creatures like pteranodons down at the bottom. Why did they sort like this?
That doesn't even get in to plants. Plants wouldn't have been able to flee the flood, and so they should have laid down fossils in a completely random manner, or be sorted by density. Instead we've got a clear evolutionary progression from top to bottom.
That is all true, partially at least. It looks like the theory would explain partial sorting, but we should expect exceptions in order of deposition. Apparently the fossil record isn't perfectly arranged to match naturalism as we understand it, unless all of that is being misquoted.
Hydroplating and it's proponents have so far failed to adequately explain how marine life survived this event. A very large portion of marine life are stenohaline, this means they can only survive in narrow range of salinity.
Now, freshwater can sit on top of salt water, but it mixes very easily, pretty much any motion would mix the two. The motion described in hydroplating is fairly violent, the waters would mix. Even without motion, they would mix within days, a short enough time that any stenohaline species right now would die.
Hydroplating is a young earth theory. It necessarily excludes evolution (and hyrdoplating theorists also claim macro-evolution does not exist). If this is true, the majority of marine species would be euryhaline, able to survive in more than one salinity range. Also, not even all euryhaline are able to survive broad salinity ranges, they just change environments at some point during their life (like being born/breeding in freshwater than moving to salt water once mature).
Not only is the salinity important, but the type of salts as well. Not all salt is the same, certain kinds of salt will kill marine life.
When Mt. St. Helens erupted lakes most affected were unable to support plankton for two years, it still took another 8 years after that for them to really start to look like they did before the eruption. After that the lake started to repopulate from fish reproduction in neighboring areas, but during the hydroplating event, there were no neighboring areas.
Hydroplating either would have killed the majority of sea life, or only highly adaptable species would have remained, those that can survive wide ranges of salinity, temperature and turbidity. There was no where where they could have hid to survive this calamity, they had to survive it right in the middle of all this chaos under the water.
FWIW, here's an attempt at an explanation.
Saint Caleth wrote:
The fact that the Bible gets the occasional fact about nature correct does not mean that you can start making up theories to support your preconceived notions, which is what hydroplate theory is. IT begins with the idea that the biblical notion of the flood is correct and then tries to contort various scientific principles to "prove" it. That is exactly the opposite of how scientific thinking works, as I and many other commenters have noted.
As far as I can see modern scientific thinking begins with denying the Biblical notion of the flood and then tries to contort various scientific principles to "prove" it. Everyone has assumptions and biases. Do you think that creationists have confirmation bias, but naturalists are somehow immune?
I think that thejeff just about covered this, but it is ludicrous to suggest that modern scientific theory began with denying the bible. Science begins with facts that are observed and reported, it does not have an agenda beyond making the simplest explanation of the facts at hand. In this case, the consistent principles of evolution and change over billions of years explains the observable facts of the world without resorting to cockamamie schemes of collapsing pillars and animals running for high ground, just in order to justify something written in the early Iron Age.
I'll need to take a look at that. Do you have links for your references?
On the subject of poling, the external refrences that I found say that it can only happen within a crystalline domain and not between multiple crystalline domains. By symmetry, I mean essentially the shape of the crystal., not the arrangement of the individual small crystals in the quartz.
I found a very good short deifinition of poling here and here. If you have trouble understanding any of the chemistry talk in those definitions I will be happy to help explain. Poling only works within a single crystal, it cannot happen between many small but separate crystals, such as would exist in a piece of quartz.
He has a whole lot of predictions, a few of which have already been confirmed. He also has explanations that make quite a lot of sense. Sounds like a theory to me.A theory has never been demonstrated wrong, even once. Hydroplate has too many things make no sense or are completely wrong, and its "predictions" only describe known events. At the top of the list is deposition.
Firstly, did you get the chance to look over Part I? He lists some objections to naturalistic theories there.
Secondly, list of predictions:
1. many fossilized whales in western Chile (47)2. pooled water under mountains (125)
3. salty water in very deep granite cracks (126)
4. deep channels under Bosporus and Gibraltar (128)
5. fracture zones mark high magnetic intensity (136)
6. magnetic strength grows at hydrothermal vents (136)
7. Earth is shrinking(154)
8. granite layer deep under Pacific floor (160)
9. shallow-water fossils in and near trenches (160)
10. inner core’s spin is decelerating (170)
11. age sequences wrong for Hawaiian islands (173)
12. thin, parallel, extensive varves not under lakes (184)
13. sand dunes from Canyon (204)
14. unique chemistry of Grand and Hopi basins (206)
15. slot canyons have cracks up to 10 miles deep (208)
16. Grand Canyon’s inner gorge is a tension crack (208)
17. fault under East Kaibab monocline (220)
18. loess at bottom of ice cores (251)
19. muck on Siberian plateaus (251)
20. rock ice is salty (251)
21. carbon dioxide bubbles in rock ice (252)
22. muck particles in rock ice (252)
23. no fossils below mammoths (252)
24. radiocarbon dating mammoths (253)
25. ice age can be demonstrated (266)
26. salt on Mars (283)
27. moons around some comets (284)
28. mass of solar system heavier than expected (286)
29. a few comets reappear unexpectedly (286)
30. excess heavy hydrogen in 5+-mile-deep water (287)
31. salt and bacteria in comets (287)
32. Oort cloud does not exist (295)
33. no incoming hyperbolic comets (296)
34. argon only in comet crust (296)
35. asteroids are flying rock piles (307)
36. rapidly spinning asteroids are well-rounded (307)
37. asteroid rocks are magnetized (311)
38. deuterium on Themis (311)
39. water is inside large asteroids (311)
40. mining asteroids too costly (311)
41. Deimos has a very low density (314)
42. Mars’ sediments deposited through air (318)
43. heavy hydrogen in space ice (318)
44. comets are rich in oxygen-18 (360)
45. lineaments correlate with earthquakes (360)
46. little radioactivity on Moon, Mars (363)
47. carbon-14 in “old” bones (429)
48. bacteria on Mars (455)
49. spin rate and direction of Ceres (323)
You do not need any fancy radiometric dating to figure out the RELATIVE ages of fossils. Older stuff goes at the bottom. We know this because of how sedimentary rocks are formed, a process we can directly observe at every stage today. If you want to say this is circular, you'll have to say HOW its circular.
I still don't think that uniformitarianism (or even catastrophism) is as good an explanation as liquefaction. What I find to be circular is that it seems like geologists say "Hey, look at how well the geologic column supports evolution.", then biologists say "Hey, look how well evolution supports the geologic column." Stuff like that. It seems like naturalism is using naturalism to defend itself.
With a world wide flood you should have rocks and fossils going bottom to top from biggest to smallest. Mastodon skulls should be right next to triceratops skulls: they are not. Sedimentary rocks should go from congolmerates up to fine clays: they do not.
I've already addressed animals. As far as sediments go, you mean cyclothems are common and that's the approximate order of them. It seems like you're objecting by saying that all of the sediments in the world should be sorted by density, with all of the conglomerates in one layer and all of the fine clays in another. However, that's not what the theory calls for in the first place. To paraphrase, he says that liquefaction didn't happen evenly enough over large distances (in all dimensions) and that some sediments experienced liquefaction more than others. That would mean that sediments would be partially, but not completely, sorted.
You can see an orderly progression through time. This was the case even before we understood evolution: the thing that was causing the progression. How is it that science and geology independently arrived at the same answer. Physics came along later and added more confirmation. Why are these three different branches of science all giving us the same answer?
It goes into what I said about naturalism supporting itself. Isn't it a possibility that when naturalistic theories were formed that the scientists innovating them were biased and not wanting a theistic explanation? The first guy comes along and says that uniformitarianism is awesome. The next guy says that uniformitarianism and macro-evolution are awesome. Then the next guy says that all of that and the Big Bang theory are awesome. Then they get put in textbooks and taught to everyone as essentially absolute truth. Sounds like there was a possibility for scientific theory to go wrong here. If there was any possibility of bias people would be likely to form theories accordingly and to dismiss contradictory evidence. Hence confirmation bias. I'm more than happy to admit that creationists have that too. I just don't like naturalists being pictured as being immune by comparison.
I'm not saying that any of you are trying to imagine away God by using science to replace Him as necessary. All my position is is that it's possible that the innovators of naturalistic theory were biased in that direction and that many people ever since then have been blinded about the scientific facts by an educational and media system that are saturated by naturalistic theory.
The explanation offered, that the dinosaurs are down below because they were clumsier and less able to avoid the incomming flood, quite frankly sucks. There's no reason that an archeopterix, Procompsognathus, or pteranadon would be less able to avoid the flood than a mammoth. There's no reason that the flood should be more deadly to a blue whale than a pleisiasaur.
Even if it were true, it could only be true as a statistic. You would expect to find ONE giant ant eater at least that was slow or lame and couldn't get away any faster than the brontosaurus. (patty is a girls name)
There's really no excuse for buying this explanation. He can hide all of his other obfuscation behind confusing technobabble and graphs, but seriously, "The pteranadon couldn't fly out of the way but the mammoth could run away" doesn't require a degree in anything to see through.
How about the supposed out of order fossils?
According to the theory, radioactivity began by the piezoelectric effect in quartz in the crust during the flood. I don't remember Jupiter having quartz, so I don't see how mentioning Jupiter is relevant.The piezoelectric effect only causes the electricity. It doesn't directly do anything to the atoms: so as long as you have the electricity you should, if that guy is right, be tossing off atoms left and right.; The thing is that jupiter generates that level of electricity all the time in lightning storms.
You seem to be confusing the source of the electricity (piezoelectric effect) with any demonstrable effect on the atoms. That's pinching (z pinching or theta pinching) that does that, which isn't dependant on having quartz nearby.
He's also using the numbers of the granite as if it were 27% of quartz because it is 27% quartz.. it doesn't work like that.
That seems like a fair argument. I'll have to look into it.
If I link you to something on the site, will you be able to check the references that go along with it? Most of his claims have some references and they're conveniently linked for his readers.What your creationist is further overlooking is that our best machine, which uses far, far more electricity per unit of area than he's talking about, can only make the fusion of Deutirium (heavy hydrogen) easier. We can't do it with anything heavier... not even hydrogen.
http://en.wikipedia.org/wiki/Z_machine
There's no way this effect made uranium without destroying the planet.
He's saying Deuterium formed by large scale neutron capturing by Hydrogen in the subterranean water. Is there a better explanation for it out there, considering Deuterium burns so easily that little to none would have been likely to have survived the Big Bang?
Why is the Uranium 235 to Uranium 238 ratio so consistent across the world? Why do we still have so much Uranium as its half-life of 700 million years is relatively short? Why is Uranium that was supposedly part of the nebular cloud so highly concentrated in a few ores on Earth? Why are a few Uranium ores in Oklo partially depleted? Why is radioactivity confined to only the first few miles of the Earth's surface (based on levels of geo-thermal heat.)? See, questions are fun. :P
In case it makes a difference, he's not saying that Uranium formed directly. He's saying that many atoms fused into superheavy elements and then fission and decay took place, forming Uranium and many other elements. Superheavy elements was a result of the Proton 21 experiement in the Ukraine if I remember correctly.
Do you think it is more prideful for me to stick to my position than for other people to stick to theirs?In this case yes, because your position is glaringly and obviously wrong. Physics, biology, paleontology, geology, astronomy, archeology, zoology and anatomy are ALL telling you you're wrong and you're insisting that you're right based on half baked excuses parading around as explanations.
Well, different people believe differently. I see no need to repeat my take on how different branches of scientific theory interrelate.
The geocentrists had their reasons for reading the bible the way they did too.
I'd like to see a geocentric theory based on the Bible that uses proper exegesis according to the original Hebrew and Greek of the Bible and makes more sense than a heliocentric theory. I doubt one exists. I can't say the same for Young Earth Creationism over Old Earth Creationism.
Sorry if I'm being frustrating or controversial here, I'm just expressing my viewpoint. Thanks for the challenges everyone. :)
I think that thejeff just about covered this, but it is ludicrous to suggest that modern scientific theory began with denying the bible. Science begins with facts that are observed and reported, it does not have an agenda beyond making the simplest explanation of the facts at hand. In this case, the consistent principles of evolution and change over billions of years explains the observable facts of the world without resorting to cockamamie schemes of collapsing pillars and animals running for high ground, just in order to justify something written in the early Iron Age.Saint Caleth wrote:
The fact that the Bible gets the occasional fact about nature correct does not mean that you can start making up theories to support your preconceived notions, which is what hydroplate theory is. IT begins with the idea that the biblical notion of the flood is correct and then tries to contort various scientific principles to "prove" it. That is exactly the opposite of how scientific thinking works, as I and many other commenters have noted.
As far as I can see modern scientific thinking begins with denying the Biblical notion of the flood and then tries to contort various scientific principles to "prove" it. Everyone has assumptions and biases. Do you think that creationists have confirmation bias, but naturalists are somehow immune?
I agree that science itself can't have an agenda. However, you said that it's observed and reported. By whom? If it's by a person, there most certainly can be an agenda. Not that it always happens, but it can.
I found a very good short deifinition of poling here and here. If you have trouble understanding any of the chemistry talk in those definitions I will be happy to help explain. Poling only works within a single crystal, it cannot happen between many small but separate crystals, such as would exist in a piece of quartz.I'll need to take a look at that. Do you have links for your references?
On the subject of poling, the external refrences that I found say that it can only happen within a crystalline domain and not between multiple crystalline domains. By symmetry, I mean essentially the shape of the crystal., not the arrangement of the individual small crystals in the quartz.
I'm not seeing any contradictions between those sites and the theory. Perhaps I've been confusing in how I paraphrase the theory, but it looks like he says that poling happened to the individual crystals themselves, rather than the entire structure.
He's saying Deuterium formed by large scale neutron capturing by Hydrogen in the subterranean water. Is there a better explanation for it out there, considering Deuterium burns so easily that little to none would have been likely to have survived the Big Bang?
Sorry to but in on your discussion with BNW when you have a perfectly good discussion with me going on as well, but I think that you have a misconception about what Deuterium is. Deuterium is not an element or chemical compound, it is an isotope of Hydrogen, meaning that any time Hydrogen occurs, either as Hydrogen gas or in some other compound, a tiny percentage of it (0.0156% to be specific) is Deuterium, evenly distributed through the Hydrogen. Therefore your assertion about "all of the Deuterium burning off" does not make any sense, since for that to happen, all of the Hydrogen in the universe would have to burn up. The isotopic ratio of Hydrogen is in fact one of the major pieces of evidence for the Big Bang, although I am a little sketchy on the details since I am a chemist and not an astronomer.
Incidentally, if Dueterium being crated by neutron capture were true, deuterium could be produced by nuclear reactors, which does not happen.
For now, I agree that science itself can't have an agenda. However, you said that it's observed and reported. By whom? If it's by a person, there most certainly can be an agenda. Not that it always happens, but it can.
Data is observed and reported by scientists, but not just by one scientist. One of the core tenets of doing proper science is repeatably. This means that any other scientist should be able to read a published paper and if they want, re-create the experiment and get the same results. This results is a self-correcting system, the efficacy is which can be illustrated by these cases of scientists being caught changing data to fit the point they wanted to make and getting caught. So while once scientist may very well have an agenda (such as the developer of hydroplate theory), it is one of the responsibilities of the wider scientific community to check for this sort of misconduct. When you actually do science, most of your time is spent reading papers describing experiments done by others.
I'm not seeing any contradictions between those sites and the theory. Perhaps I've been confusing in how I paraphrase the theory, but it looks like he says that poling happened to the individual crystals themselves, rather than the entire structure.
I think that one of us is misunderstanding the theory somewhat. My understanding is that the theory relies on the poling effect aligning the individual small crystals which make up 27% of the granite rock into the correct symmetrical arrangement, which is the only conceivable way that granite could be piezoelectric overall. Poling actually only aligns the dipoles (think of them as little tiny virtual magnets) within one large crystal or the appropriate shape to make the singe piece of crystal peizoelectric. There is no way that it can make a piece of granite produce electricity.
Firstly, did you get the chance to look over Part I? He lists some objections to naturalistic theories there.
I did. They're trite, horrible misunderstandings of science itself or (paradoxily) wondering why science hasn't found the answer to every tiny detail yet.
For example, after the $20,000,000,000 lunar exploration program, no evolutionist can explain with any knowledge and confidence how the Moon formed
Ok, so we're not entirely sure how the moon formed. We think we have a good idea , but we're not sure. Why is that a problem? Its a 3 billion year old cold case and all of humanity has spent less time on the moon than you've spent online.
Macroevolution has never been observed in a breeding experiment
Huh. Really. We've never seen something that takes hundreds of thousands of years in a process we only invented 300 years ago. I wonder why.
1. A sedimentary layer often spans hundreds of thousands of square miles. (River deltas, where sediment thicknesses are greatest, are a tiny fraction of that area.) Liquefaction during a global flood would account for the vast expanse of these thick layers. Current processes and eons of time do not.
The next guy says that uniformitarianism and macro-evolution are awesome.
But he did so based largely on the living species themselves. It explains the large confusing morass of living varieties gently shading into different species based on geographic location.
Extinction, which was an antibiblical concept, explained why there wasn't just ONE smooth gradation between all species: some of the tree was missing.
Sounds like there was a possibility for scientific theory to go wrong here.
There was no way to keep missing uniformitarianism forever. If Lyle hadn't published on it someone else would have. If darwin hadn't had the best and most comprehensive explanation of evolutioni Alfred Russel Wallace would have gotten the ball rolling.
Scientific theories are tested up and down, forward and back. They're compared to reality and dropped like a hot potato when they've been found wanting. Uniformitarianism and Evolution by natural selection have been tested for over 200 years without being overthrown because they're RIGHT.
I know the liberal arts types hate to hear this, but its true: science accurately describes an objective reality. It is not a cultural narrative. It is not dependent on the personalities involved. It depends on what IS.
I just don't like naturalists being pictured as being immune by comparison.
Ok, so EVERY field of science is having some massive, global conspiracy of confirmation bias and they're ALL managing to line up their answers without error? ... how the bleep would that even be possible?
Write a work of fiction with 100 different characters. TRY to keep them all consistent and interacting with each other without having any plotholes. Good luck. Now, imagine doing the same thing with 1,000 characters and 10,000 different authors.
There's no way that this many branches of science could ALL be giving the exact same answer without something rigging the deck: either reality really did turn out the way scientists think or some deity level creature is making it look like it did. (those field mice can be tricky)
All my position is is that it's possible that the innovators of naturalistic theory were biased in that direction and that many people ever since then have been blinded about the scientific facts by an educational and media system that are saturated by naturalistic theory.
Its entirely possible that you're a mutagenic space slug on sigma six trolling the internet. Without any plausible evidence for that i really shouldn't make the assertion.
*peeks for tentacle*
BigNorseWolf wrote:
How about the supposed out of order fossils?
Could you perhaps, back your explanation for something without bouncing around to yet another topic? You're beggining to retread things we've already disproven (like the "problems" with c14 dating)
He's saying Deuterium formed by large scale neutron capturing by Hydrogen in the subterranean water. Is there a better explanation for it out there, considering Deuterium burns so easily that little to none would have been likely to have survived the Big Bang?
Nuclide Data
Natural abundance 0.015%Half-life Stable
Isotope mass 2.01410178 u
Spin 1+
Excess energy 13,135.720±0.001 keV
Binding energy 2,224.52±0.20 keV
Deuterium isn't radioactive. Once you form it (like in the big bang) it doesn't "burn" off and become something else. You can combine it with oxygen to make water, make sugars out of it, stick it in a blender.. whatever you do with the hydrogen its still going to keep the extra neutron until you fuse it to another atom or something.
Why is the Uranium 235 to Uranium 238 ratio so consistent across the world?
Tired of looking stuff up.. i think its because all of the uranium on earth came from the same supernova (it would be odd to have two supernova that close to each other) and thus is set to the same time.
Why do we still have so much Uranium as its half-life of 700 million years is relatively short?
Because uranium zig zags as it looses particles through radioactivity, it goes from being uranium to being something else back to uranium again
238U radiates alpha-particles and decays (by way of thorium-234 and protactinium-234) into uranium-234. 234U has a half-life of 245,500 years. The relation between 238U and 234U gives an indication of the age of sediments that are between 100,000 years and 1,200,000 years in age.[5]
238U occasionally decays by spontaneous fission or double beta decay with probabilities of 5×10−5 and 2×10−10 per 100 alpha decays, respectively.[6]-wiki.
Why is Uranium that was supposedly part of the nebular cloud so highly concentrated in a few ores on Earth?
Off the cuff: its rather dense as the planet was forming there would have to be something keeping it from just sinking.
Why are a few Uranium ores in Oklo partially depleted? Why is radioactivity confined to only the first few miles of the Earth's surface (based on levels of geo-thermal heat.)? See, questions are fun. :P
Its 3 am. if you actually want to know i can google tommorow.
In case it makes a difference, he's not saying that Uranium formed directly. He's saying that many atoms fused into superheavy elements and then fission and decay took place, forming Uranium and many other elements. Superheavy elements was a result of the Proton 21 experiement in the Ukraine if I remember correctly.
There's barely enough voltage in his calculations to reach z pinch with hydrogen.
Well, different people believe differently. I see no need to repeat my take on how different branches of scientific theory interrelate.
There's different and then there's objectively wrong. Science simply did not do what you think it did. If it had, it would have fallen apart by now. You CAN"T keep a fiction that big perfectly coherent across the globe and accross major paradigm shift like the discovery of DNA.
Explain this one: before people ever reached the south pole, evolutionists predicted marsupial fossils... in Antarctica. They were right.
I'd like to see a geocentric theory based on the Bible that uses proper exegesis according to the original Hebrew and Greek of the Bible and makes more sense than a heliocentric theory.
The trials from galileo have to be around somewhere on the net. I think you'd be hard pressed to say that you know the bible better than those folks.
Sorry if I'm being frustrating or controversial here, I'm just expressing my viewpoint. Thanks for the challenges everyone. :)
The bouncing around is a little frustrating, especially when you go back to something you've already covered.
The general handwave where you say that something is biased/incorrect/not studied so it doesn't need to be investigated
But we're not swearing at each other yet so you know.. progress... :k
|
Nategar,
The fossil evidence is only a tiny fraction of the evidence we have for evolution. The genetic evidence is far more overwhelming. The IRV commonalities that precisely match the evolutionary theory, for example. Or the telomeres in middle of our chromosome 2 which itself appears to be two fused chimpanzee chromosomes. The list does go on for quite a bit.
Also, given you're criticiing other people for not understanding your pet theories, you show a marked lack of understanding of, so far, physcis, biology, astronomy, geology and probably half a dozen other sceintific disciplines. How about you correct your own plank before commenting on our spekcks, huh?
Also, you claim science is anit-Christian. B*@*@+%s. Millions of prominant scientists are Christians. Millions more have faith in a different higher power. They just view the Bible as allegory rather than literal truth. Especially given the poetic structure used in Genesis (not to mention the fact that Genesis 1 and 2 disagree on things far worse than you claim science does). Also, apparently you didn't know that the first people to disprove the Flood hypothesis where Christian creationists such as Adam Sedgewick who was an ordained minister. He hated God, huh? Wrong. He set out trying to prove the Flood hypothesis and found no evidence at all for a global flood.
EDIT: Oh, and the 'lack of radioactivity in Noah's time'? Pure and total b**%&**&. They would still have to deal with the massive amounts of UV light that the sun puts out every day. Oh, look, that's radioactivity and causes changes in DNA, which we know, it's why we get skin cancer.
EDIT 2: DNA from RNA. Well, we kind of do see this on a regular basis every time a protein is stranscribed. It first goes through a process of transcribing from DNA to RNA. This is incredibly ineffiecitn and makes far more sense to be an artefact process from the original RNA genetic form than any other explanation so far advanced.
| 2 people marked this as a favorite. |
If you're relcutant to carefully read things by secular geologists, and prefer a more "faith-friendly" series of informative writings on why a global Flood, while an excellent allegory, is not a literal historical event, you might check out The Bible, Rocks and Time: Geological Evidence for the Age of the Earth by Davis Young and Ralph Stearley, two devout Christians. Also, J. Laurence Kulp, a Wheaton alumn, geochemist, and member of the Plymouth Brethren, wrote an excellent article refuting flood geology: Kulp, J. Laurence, 1950, Deluge geology. Journal of the American Scientific Affiliation, 2 (1): 1–15.
Also don't forget St. Augustine:
Usually, even a non-Christian knows something about the earth, the heavens, and the other elements of this world, about the motion and orbit of the stars and even their size and relative positions, about the predictable eclipses of the sun and moon, the cycles of the years and the seasons, about the kinds of animals, shrubs, stones, and so forth, and this knowledge he holds to as being certain from reason and experience. Now, it is a disgraceful and dangerous thing for an infidel to hear a Christian, presumably giving the meaning of Holy Scripture, talking non-sense on these topics; and we should take all means to prevent such an embarrassing situation, in which people show up vast ignorance in a Christian and laugh it to scorn. The shame is not so much that an ignorant individual is derided, but that people outside the household of the faith think our sacred writers held such opinions, and, to the great loss of those for whose salvation we toil, the writers of our Scripture are criticized and rejected as unlearned men. If they find a Christian mistaken in a field which they themselves know well and hear him maintaining his foolish opinions about our books, how are they going to believe those books in matters concerning the resurrection of the dead, the hope of eternal life, and the kingdom of heaven, when they think their pages are full of falsehoods on facts which they themselves have learnt from experience and the light of reason? Reckless and incompetent expounders of holy Scripture bring untold trouble and sorrow on their wiser brethren when they are caught in one of their mischievous false opinions and are taken to task by those who are not bound by the authority of our sacred books. For then, to defend their utterly foolish and obviously untrue statements, they will try to call upon Holy Scripture for proof and even recite from memory many passages which they think support their position, although 'they understand neither what they say nor the things about which they make assertion.
Also don't forget St. Augustine:
Wow. Hadn't realized the argument went back to 415.
I'm not always as clear as I should be in my posts and for that I apologize. That may be why many of you get the impression that I'm ignorant about naturalistic theories. I consider myself to have a fairly firm grasp on the basics. I did learn all of this in school and do like reading about science after all. When you respond, don't be afraid to use technical language in your posts. I know what isotopes and dipoles are, for instance. I don't want to brag, but I do want to make that clear. The reason I quote so heavily from that site is because I don't want his theory to be misrepresented by me because I know my limits of paraphrasing, especially when I don't have a lot of time for posting.
However, I wouldn't by any means consider myself to know as much as you (or at least many of you) on all of the specifics. I don't know everything and I don't want to imply that I think I do. There are some objections that you all raise that I may not be able to answer, at least not right away. I try to make it a point to concede those points when that happens.
BNW, I'll get to your post later because it's kinda long. For now, I saw that you mentioned Antarctica. I don't know how to respond to your question about marsupials. For one thing, I wasn't previously aware of it, so I'll have to look into it. Since you mentioned Antarctica, I wonder what all of you think of this.
Nategar,
The fossil evidence is only a tiny fraction of the evidence we have for evolution. The genetic evidence is far more overwhelming. The IRV commonalities that precisely match the evolutionary theory, for example. Or the telomeres in middle of our chromosome 2 which itself appears to be two fused chimpanzee chromosomes. The list does go on for quite a bit.
By IRV, I assume you mean retroviruses. I'm familiar with them and with telomeres. I'll grant that it makes sense within an evolutionary framework for the genetics to match up, at least to a certain extent. However, all that these similarities really prove is similarity. It could be from common descent, but it could also be from common design. We build stuff all the time and we frequently use very similar base materials in very similar ways for different objects because we have very similar intended uses for them. The things that we build frequently have things in common because they had a common designer: mankind. If God really did create everything, why shouldn't we expect similar features throughout creation?
Also, given you're criticiing other people for not understanding your pet theories, you show a marked lack of understanding of, so far, physcis, biology, astronomy, geology and probably half a dozen other sceintific disciplines. How about you correct your own plank before commenting on our spekcks, huh?
I'll grant that I'm not an expert on naturalistic theories and shouldn't be so harsh with others. I apologize for that.
Also, you claim science is anit-Christian. B%@$#@&s. Millions of prominant scientists are Christians. Millions more have faith in a different higher power. They just view the Bible as allegory rather than literal truth. Especially given the poetic structure used in Genesis (not to mention the fact that Genesis 1 and 2 disagree on things far worse than you claim science does). Also, apparently you didn't know that the first people to disprove the Flood hypothesis where Christian creationists such as Adam Sedgewick who was an ordained minister. He hated God, huh? Wrong. He set out trying to prove the Flood hypothesis and found no evidence at all for a global flood.
I never claimed science itself was anti-Christian. Romans 1 and Psalms have plenty to say about seeing evidence for God through His creation. All I've been claiming is that science as understood by evolutionists doesn't line up with what the Bible says as far as I understand it.
I never said that you had to hate God to not believe in a young Earth and a global flood and I apologize if I implied it. There are plenty of honest, God loving Christians who don't agree with me on this subject. I'd consider them misguided on this issue, but I don't question the legitimacy their faith.
EDIT: Oh, and the 'lack of radioactivity in Noah's time'? Pure and total b**@##!~. They would still have to deal with the massive amounts of UV light that the sun puts out every day. Oh, look, that's radioactivity and causes changes in DNA, which we know, it's why we get skin cancer.
I overstated my case on this point. I meant that it was the origin of most of the radioactivity found on Earth, including virtually all of it that originates in the crust. I also pointed out that radiocarbon wasn't affected anywhere near as much by the same mechanism as the rest of the radioactive stuff (because carbon is frequently part of the biosphere, rather than in the crust itself.). Here's an idea of why preflood ages would have been as high as reported in the Bible.
As to why I wasn't more clear, for some reason I thought that all of you would know that I knew about uv light's effects and was considering it in my argument. In retrospect it was a very silly mistake to make.
EDIT 2: DNA from RNA. Well, we kind of do see this on a regular basis every time a protein is stranscribed. It first goes through a process of transcribing from DNA to RNA. This is incredibly ineffiecitn and makes far more sense to be an artefact process from the original RNA genetic form than any other explanation so far advanced.
Firstly, I don't claim that the creation as it is now should be perfect. Genesis 3 and Romans 8 talk about the negative effects that sin has had on the universe itself.
Speaking of Romans 8, it speaks of creation's "bondage to decay". That seems similar, at least in principle, to the second law of thermodynamics at a time that mankind couldn't have known about it, at least in the sense of energy decay. Weren't many "scientific" people in the 1st century saying that the universe was eternal? Seems interesting, but perhaps I'm simply off on that.
Secondly, many times people only look at one aspect of something and say that it's inefficient. It may be the case that something could've been designed better in one area, but it would have been too much of a detriment to another area. Tradeoffs are always necessary to reach the best overall design.
Thirdly, I still haven't heard an explanation on where the genetic information embedded could have came from in the first place. Information invariable only comes from intelligence. Its existence in nature requires an intelligent source. All chemical affinity and self ordering gives you is unspecified complexity.
For instance, let's say you're driving down a highway. You see a license plate that says "5066 NM" and another that says "936 5768". You think nothing of them because you assume they're just a random combination of letters and numbers. Then you see a license plate that says "Batman" and think "Wow, that's the best license plate I've seen all day. I'm so happy to find another Batman fan out there.". Well, probably not because you probably don't obsessively look at license plates. Anyway, my point is that information only comes from intelligence.
Why should DNA be the exception? How could it be an exception? It seems exceedingly statistically unlikely, just like many other of the huge gaps I see in possibility for naturalistic theories of origins to work. All I see is appeal to probability, a nice logical fallacy that says that just because something "can" happen, that it eventually will.
Human DNA contains more organized information than the Encyclopedia Britannica. If the full text of the encyclopedia were to arrive in computer code from outer space, most people would regard this as proof of the existence of extraterrestrial intelligence. But when seen in nature, it is explained as the workings of random forces.[/url]
If you're relcutant to carefully read things by secular geologists, and prefer a more "faith-friendly" series of informative writings on why a global Flood, while an excellent allegory, is not a literal historical event, you might check out The Bible, Rocks and Time: Geological Evidence for the Age of the Earth by Davis Young and Ralph Stearley, two devout Christians. Also, J. Laurence Kulp, a Wheaton alumn, geochemist, and member of the Plymouth Brethren, wrote an excellent article refuting flood geology: Kulp, J. Laurence, 1950, Deluge geology. Journal of the American Scientific Affiliation, 2 (1): 1–15.
Thanks, I appreciate that. It doesn't bother me to read things by secular scientists. In my view it's not so much that I don't trust secular scientists. I simply don't trust the assumptions behind their methodology, such as uniformitarianism. It's those assumptions that I don't agree with and old earth creationists (knowingly or not) use the same assumptions. Because of this, scientifically speaking I disagree with old earth creationists in a similar way than atheists who say much the same things while leaving out God as active in the process.
So, I appreciate that you were thoughtful enough to find that and I'll look at it when I have the chance, but I'm fine with reading secular scientific papers.
Also don't forget St. Augustine:
Usually, even a non-Christian knows something about the earth, the heavens, and the other elements of this world, about the motion and orbit of the stars and even their size and relative positions, about the predictable eclipses of the sun and moon, the cycles of the years and the seasons, about the kinds of animals, shrubs, stones, and so forth, and this knowledge he holds to as being certain from reason and experience. Now, it is a disgraceful and dangerous thing for an infidel to hear a Christian, presumably giving the meaning of Holy Scripture, talking non-sense on these topics; and we should take all means to prevent such an embarrassing situation, in which people show up vast ignorance in a Christian and laugh it to scorn. The shame is not so much that an ignorant individual is derided, but that people outside the household of the faith think our sacred writers held such opinions, and, to the great loss of those for whose salvation we toil, the writers of our Scripture are criticized and rejected as unlearned men. If they find a Christian mistaken in a field which they themselves know well and hear him maintaining his foolish opinions about our books, how are they going to believe those books in matters concerning the resurrection of the dead, the hope of eternal life, and the kingdom of heaven, when they think their pages are full of falsehoods on facts which they themselves have learnt from experience and the light of reason? Reckless and incompetent expounders of holy Scripture bring untold trouble and sorrow on their wiser brethren when they are caught in one of their mischievous false opinions and are taken to task by those who are not bound by the authority of our sacred books. For then, to defend their utterly foolish and obviously untrue statements, they will try to call upon Holy Scripture for proof and even recite from memory many passages which they think support their position, although 'they understand neither what they say nor the things about which they make assertion.
That is a very thought provoking quote. Thank you.
I agree that science itself can't have an agenda. However, you said that it's observed and reported. By whom? If it's by a person, there most certainly can be an agenda. Not that it always happens, but it can.In my view it's not so much that I don't trust secular scientists. I simply don't trust the assumptions behind their methodology, such as uniformitarianism.
My main point is that origins science on either side relies on unprovable assumptions. We weren't there and didn't see it. It won't happen again. I'm not so much saying that there's a conspiracy. It's more like I don't think people always question their assumptions enough to realize that they're not necessarily true. I apologize for repeating it, but I was just trying to get my point across. I can tone that down, but it's fundamental to my worldview and can't easily just drop it when people challenge the concept of assumptions.
Well, for one thing he's made predictions, a few of which have already been confirmed.
I suppose finding naturally occurring subterranean super-critical water would be a good start. Actually, they did find that:
Figure 56: Black Smoker. Black smokers, some as hot as 867ºF (464ºC), were discovered in 1977 jetting up on a portion of the Mid-Oceanic Ridge in the Pacific. Many other black smokers have since been found along the entire, globe-encircling Mid-Oceanic Ridge, even inside the Arctic Circle. As the hot water shoots up into the frigid ocean, dissolved minerals (and on rare occasions, asphalt) precipitate out, giving the smoker its black color. It is now known that the water was initially supercritical water (SCW)48 that held vast volumes of dissolved minerals such as copper, iron, zinc, sulfur, and sometimes hydrocarbons. SCW has been produced by man in strong, closed containers, but it had never before been seen in its natural state, even around volcanoes.
According to evolutionary geology, water not in a closed container seeps down against a powerful increasing pressure gradient a few miles below the ocean floor. There, magma (molten rock) heats the water to these incredible temperatures, forcing it back up through the floor. (SCW could not form by such a process, because of the two conditions highlighted in bold above. Uncontained liquid water, heated while slowly seeping downward, would expand, rise, and cool, long before it became supercritical.) Figure 55 gives a simple explanation. Besides, if the evolutionary explanation were true, the surface of the magma body would quickly cool, form a crust, and soon be unable to transfer much heat to the circulating water. (This is why people can walk over magma days after a crust has formed. The crust insulates the hot magma.) However, black smokers must have been active for many years, because large ecosystems (composed of complex life forms such as clams and giant tubeworms) have had time to become established around the base of smokers.
(Emphasis in original)
“Even Jules Verne didn’t foresee this. Down at the bottom of the Atlantic Ocean is the hottest water on Earth, in a ‘supercritical’ state never seen before in nature ... and could offer a glimpse of how minerals such as gold, copper and iron are leached out of the entrails of the Earth and released into the oceans. Its water, but not as we know it ... .” Catherine Brahic, “Superheated Water Spews from the Seabed,” New Scientist, Vol. 198, 9 August 2009, p. 14.
That's the subterranean water according to the theory.
Thanks, I appreciate that. It doesn't bother me to read things by secular scientists. In my view it's not so much that I don't trust secular scientists. I simply don't trust the assumptions behind their methodology, such as uniformitarianism.
This is VERY important.
Uniformitarianism is NOT an assumption. Its a conclusion. Its a conclusion based on so much evidence, that explains and predicts so much of what we see around us, that it has become a fact. And for good reason.
The idea that we can only use direct evidence (seeing it ourselves) is silly. History will never happen again, but we have a good idea of what happened. The 1998 world series will never happen again, but its on tape to watch. If we find bloody gloves with someone's DNA in side, their dead wife, their blood all over the place, and the vicitms blood all over his place, its a reasonable conclusion that he killed her. (outside of california anyway)
Re, the map: Either that's south america sticking down or someone took a trip over to antarctica.
There are many difficulties in the map of South America, including duplication of rivers. Close examination of the coastline supports the alternative theory that the "extra" landmass is simply the South American coast, probably explored in secret by Portuguese navigators, and bent round to fit the parchment. There are features resembling the basins at the mouth of the Strait of Magellan, and the Falkland Islands.[40]
Given that he's putting the map together from several sources that were probably using different projection systems, even if that IS supposed to be antarctica, there's no way to determine Antarctica with ice and Antarctica without ice. This is how one of his maps of europe looks
ZOMG all I did was ever ask!
explanation.
I read that prior to posting. A lot of his conclusions contradict other things he says. He's grasping at possibilities that just aren't possible if his main theory is correct. What I wrote is already a response to that page.
|
|
Nategar,
Information only comes from intelligence? Ah, you're a Stephen Meyers fan. Refutation
EDIT: Also, please stop using the word 'evolutionist'. It is a word used only by creationists. It has no meaning to anyone else. What you mean is the vast majrotity of scientists and the overwhelming majority of biologists. So be honest and say that. Evolutionist is a weael word to imply you and they are on equal footing. You're not. On the one side you have pretty much everyone who does science and on the other you have a bunh of religious zealots who cannot accept that their holy book is not 100% literally rtue. The recent Kiltzmeyer v Dover case proved that.
Nategar,
Information only comes from intelligence?
Let me give a succinct argument:
It's a worthless analogy because genetic "information" is in no way symbolic or referential. We have sciences (physics and chemistry) which are enormously robust in their power to explain and predict the business of self-replication at the molecular level, why atoms and molecules assort themselves in certain ways. Also, your argument is a bit similar to Hoyle's "wind blowing through junkyard assembling airplane" argument or Behe's bacterial machinery (flagellum) arguments. If I rearrange a bunch of letters in a text, it stops being meaningful and symbolic. However, since evolution is an unguided process which is not teleological, there are many diverse ways life can exist. The genetic code has diversified in a non-deterministic way since the advent of the first self-replicators. It may be hard for you to accept that matter can organize itself in ways we tend to find extremely complex, but there is nothing miraculous about it. That is simply what some matter on this planet does.
| 1 person marked this as a favorite. |
It may be hard for you to accept that matter can organize itself in ways we tend to find extremely complex, but there is nothing miraculous about it. That is simply what some matter on this planet does.
You mean God doesn't individually design each snowflake?
If I rearrange a bunch of letters in a text, it stops being meaningful and symbolic. However, since evolution is an unguided process which is not teleological, there are many diverse ways life can exist
Well, more to the point, the way DNA is translated into proteins anything that's not behind a STOP codon will tell the ribosomes to build SOMETHING. Whether or not its particularly useful something is another matter.
There is no syntax beyond start and stop really. There are no meaningless phrases. That's why the language analogy falls apart.
|
|
| 1 person marked this as a favorite. |
It may be hard for you to accept that matter can organize itself in ways we tend to find extremely complex, but there is nothing miraculous about it. That is simply what some matter on this planet does.
You mean God doesn't individually design each snowflake?
(1/50) × (1/50) × (1/50) × (1/50) × (1/50) × (1/50) = (1/50)6 = 1/15,625,000,000
"It was the best of times, it was the blurst of times. Stupid monkey!"
It may be hard for you to accept that matter can organize itself in ways we tend to find extremely complex, but there is nothing miraculous about it. That is simply what some matter on this planet does.You mean God doesn't individually design each snowflake?(1/50) × (1/50) × (1/50) × (1/50) × (1/50) × (1/50) = (1/50)6 = 1/15,625,000,000
"It was the best of times, it was the blurst of times. Stupid monkey!"
"Ford, there's an infinite number of monkeys outside that want to talk to us about this script for Hamlet they've worked out."
This will be my last post on this thread, at least for a little while. I'm too busy to keep up with everything here. Thanks for the challenges.
Thanks, I appreciate that. It doesn't bother me to read things by secular scientists. In my view it's not so much that I don't trust secular scientists. I simply don't trust the assumptions behind their methodology, such as uniformitarianism.This is VERY important.
Indeed it is. I'd consider it one of the most important points about how science and faith interact.
Uniformitarianism is NOT an assumption. Its a conclusion. Its a conclusion based on so much evidence, that explains and predicts so much of what we see around us, that it has become a fact. And for good reason.
You all trust Wikipedia, right? At least they don't have a theistic bias anyway.
They say quite a few times that it IS an assumption. Granted, they say that it's a nearly universally accepted assumption, but it's an assumption nevertheless. I'm not questioning the "laws of physics and chemistry are consistent across time and space" part of the assumption. Furthermore, in a randomly formed naturalistic universe, why should we expect constancy of physical laws?
I'm questioning the "all geological processes have always happened and will always happen at roughly the same rate as today's processes" part of the assumption. Essentially, I'm questioning gradualism.
Interestingly, many secular scientists are also questioning gradualism. They don't go from there to Biblical flood geology; instead they go to catastrophism. I find that to be a convenient way to explain the appearance of catastrophes throughout geological history and yet denying the possibility of a global flood on Earth. It seems that most secular scientists find a global flood on Mars to be a more likely possibility, despite the abundance of water on Earth. I'm betting it's because the Bible doesn't describe a global flood on Mars, but YMMV. :P
The idea that we can only use direct evidence (seeing it ourselves) is silly. History will never happen again, but we have a good idea of what happened. The 1998 world series will never happen again, but its on tape to watch. If we find bloody gloves with someone's DNA in side, their dead wife, their blood all over the place, and the vicitms blood all over his place, its a reasonable conclusion that he killed her. (outside of california anyway)
We had video cameras all over the place at the 1998 World Series as you said, but we can't say the same of the origins of life and the universe. It's a different ballgame to figure out who killed someone with forensic evidence than to figure out the mechanisms of the origins of the Earth and the universe. On that point we seem to have hit an impasse on.
Stuff on Antarctica
That's a better explanation than Ancient Aliens gave. They said aliens did it. :P
I found this link as one of Wikipedia's references. Note that it's a non-Christian and, in fact, a relatively anti-Christian site (based on an article or two I read there.). I don't know that this is right and that you're wrong as your explanation made sense too. Interesting though.
Paul: I don't know about the information thing. At first glance it seems arbitrary to define information in such a way that doesn't contradict your theory, but I don't know. I don't profess to be a genetics professor.
EDIT: Also, please stop using the word 'evolutionist'. It is a word used only by creationists. It has no meaning to anyone else. What you mean is the vast majrotity of scientists and the overwhelming majority of biologists. So be honest and say that. Evolutionist is a weael word to imply you and they are on equal footing. You're not. On the one side you have pretty much everyone who does science and on the other you have a bunh of religious zealots who cannot accept that their holy book is not 100% literally rtue. The recent Kiltzmeyer v Dover case proved that.
Well, creationists aren't considered real scientists by many people. When those people say that most scientists believe in macro-evolution what they really seem to mean is that most scientists are scientists. That seems kinda circular to me. It's easier for me to say "evolutionist" than "macro-evolutionist" or "rational scientist guy" or something like that. I apologize if that offends you and if I participate in conversations like this in the future I'll try to be more sensitive. :)
Furthermore:
“Almost all scientists accept evolution.”
Response: No, they don’t. The only related survey of scientists I am aware of was of chemists. A slight majority rejected evolution. [See the last paragraph of Endnote 2 on page 325.] Most professors in the basic sciences favor evolution, in part, because that is what they were taught and those who openly reject evolution are not hired or are fired. In the applied sciences (medicine, engineering, etc.) and among scientists in industry, those accepting and rejecting evolution may be nearly balanced. Gallup polls have shown that more Americans reject evolution than accept it.
Also, another page I found on the World-Mysteries site (once again, a non-Christian site) is here. Here's the abstract:
"Textbooks present science as a noble search for truth, in which progress depends on questioning established ideas. But for many scientists, this is a cruel myth. They know from bitter experience that disagreeing with the dominant view is dangerous - especially when that view is backed by powerful interest groups. Call it suppression of intellectual dissent. The usual pattern is that someone does research or speaks out in a way that threatens a powerful interest group, typically a government, industry or professional body. As a result, representatives of that group attack the critic's ideas or the critic personally-by censoring writing, blocking publications, denying appointments or promotions, withdrawing research grants, taking legal actions, harassing, blacklisting, spreading rumors."
Quite thought provoking. Thank you to everyone for the challenges and the opportunities to learn. :)
1. You all trust Wikipedia, right?
2. Furthermore, in a randomly formed naturalistic universe, why should we expect constancy of physical laws?
3. I'm questioning the "all geological processes have always happened and will always happen at roughly the same rate as today's processes" part of the assumption. Essentially, I'm questioning gradualism.
4. Interestingly, many secular scientists are also questioning gradualism. They don't go from there to Biblical flood geology; instead they go to catastrophism. I find that to be a convenient way to explain the appearance of catastrophes throughout geological history and yet denying the possibility of a global flood on Earth.
5. It's easier for me to say "evolutionist" than "macro-evolutionist" or "rational scientist guy" or something like that.
1. No; that would be stupid. At least, not without confirmation. You're aware that anyone can edit Wiki articles to say anything, right?
2. Natural =/= random.
3. No one says all processes happen at roughly constant rates all the time. Rather, we say that rates can be studied and are therefore not unknowable.
4. We can observe catastrophes, and the evidence they leave behind. We also see no evidence of a global flood. There's no contradiction there, any more than one atomic bomb automatically destroys the entire world.
5. "Macro-evolution" is another B.S. Creationist term. It is exactly analogous to me saying that "I accept that seconds can go by -- that's micro-time, and I'm aware of it -- but I refuse to accept that there are any such things as 'years' and that I could get a 'year older.' That's macro-time and I don't believe in it because I can't watch myself getting older in the mirror!"
This will be my last post on this thread, at least for a little while. I'm too busy to keep up with everything here. Thanks for the challenges.
No problem. Learned some stuff trying to shoot down that website.
For your own sanity, I would really, REALLY look into liquefaction as an explanation for the order of fossils. There's no magic mechanism there for sorting creatures into the order they evolved in by strata. There's no complicated scientific terms he can try to misguide you with. The ground shook, functioned as a liquid, and instead of sorting out by density, every single fossil just "happened" to sort into the exact same order you would expect them to if evolution were true.
You all trust Wikipedia, right? At least they don't have a theistic bias anyway.
Wiki, yes. Philosophers of science, no. For exactly this reason.
You have a river. It has sediment in it. That sediment exactly matches the rock that its running through. You have the same sediment as mud at the end of the river. Below that you have harder and harder layers of mud until you hit something you can't get a shovel through. If you keep digging past that you'll eventually find rock.
All of that is a very good reason to CONCLUDE, not assume, that the rock formed from deposits from the river.
The only assumption is non last thursdayism.
Furthermore, in a randomly formed naturalistic universe, why should we expect constancy of physical laws?
Uncreated is not random. The universe works according to certain rules. I don't know how those rules got there, but we can see that they are there, and that they function accross both space and time because stars that are millions of light years away give every indication of using the same rules for radiation as the atoms here on earth do.
A christian scientist explains this and a lot of your objections
I'm questioning the "all geological processes have always happened and will always happen at roughly the same rate as today's processes" part of the assumption. Essentially, I'm questioning gradualism.
You're questioning the age of the earth is what you're doing. There's no reason that you should get different results running water over rock at X velocity now vs running water over rock at x velocity 800 million years ago. There's no reason that the tectonic plates should be have much differently now than they did 800 million years ago.
The basis for your theory is that a few thousand years ago most of life and all of human history was whiped out. Yet not only does history appear to have marched on without noticing its own extinction, but there's no record of it happening in our DNA
That sort of population bottleneck sticks with a species in its DNA. If the flood had happened, all species should show a population bottleneck at the same time. We don't see that. What we see is that the changes in biology match the ones we predict from geology. How on earth is that happening
Interestingly, many secular scientists are also questioning gradualism. They don't go from there to Biblical flood geology; instead they go to catastrophism.
No. They aren't questioning gradualism. They're accepting that every once in a while something does happen quickly, like the asteroid that took out the dinosaurs.
We had video cameras all over the place at the 1998 World Series as you said, but we can't say the same of the origins of life and the universe. It's a different ballgame to figure out who killed someone with forensic evidence than to figure out the mechanisms of the origins of the Earth and the universe. On that point we seem to have hit an impasse on.
Well, the video tape undermines your assumption that its not demonstrable if its not repeatable. Obviously it IS demonstrable, the question becomes how much evidence is good enough? Physical events leave records: a dried up river leaves the canyon and valley. Glaciers leave rocks behind. Species leave behind fossils. We don't have a perfect record of every minute of every action of life on earth, but what we do have is (literal) mountains of evidence of the events left behind for us, and it all points to the same conclusion.
I find that to be a convenient way to explain the appearance of catastrophes throughout geological history and yet denying the possibility of a global flood on Earth.
The asteroid that took out the dinosaurs has as evidence
1) We know asteroids exist
2) A large amount of shaken quartz
3) A sudden loss of biodiversity in the fossil record
4) A lot of iridium spread out over the planet at the same time in between layers where the dinosaurs appear and when they no longer do.
There's little if any evidence against it.
Your god caused flood has... what as evidence for it? The page you keep linking to is either making up things that we've seen or making up predictions that aren't true. There's no universal genetic bottleneck across species. There's no point where history just stops and takes off again. Linguistics do not point back towards a similar bottleneck. Astronomy indicates that radioactivity worked the same a hundred million years ago as it does now.
Biology, Geology, physics, astronomy,chemistry, history, anthropology, linguistics, and archeology all independently conclude a very coherent picture. HOW is that possible that millions of people accross the globe and across time are cumming up with a coherent "story", openly publishing their ideas and NOT being exposed as either liars or blatantly wrong?
Against this you have your very literal interpretation of a very metaphorical book and a website with an obvious agenda and an entire slew of incorrect statements and disingenuous arguments.
It seems that most secular scientists find a global flood on Mars to be a more likely possibility, despite the abundance of water on Earth. I'm betting it's because the...
They're only predicting a global "flood" on mars in the same way that there's a global "flood" on earth in the sense that it was 3/4 covered with water.
Paul: I don't know about the information thing. At first glance it seems arbitrary to define information in such a way that doesn't contradict your theory, but I don't know. I don't profess to be a genetics professor.
The idea that information requires an intelligent mind is circular. An ameoba's DNA is telling its ribosomes "Hey, build THIS ATCGCGATAGAGAGAGCATCGCAGATCCGCCATACATATATATATATATATA" That's obviously communication of information. There's no intelligence involved. If you insist on placing God as a creator for the information you're doing so because you think information can't exist without an intelligent creator, which is your reason for denying evolution in the first place.
There's a hole in the bucket dear johny...
Go back. Forget the bible, forget what you want to be true. IMagine a mastodon, a triceratops, a T rex, an archeopterix , a wolf, a velociraptor, an ostridge, and a bunch of little dinosaurs. Now try to imagine a physical process that separates the wolf skull from the velociraptors skull and puts it with the mammoths while keeping the mammoth skull away from the triceratops. WHAT would do that? Jello? Liquid mud? Tar?
A large amount of shaken quartz
Are you trying to say "shocked" quartz? (Shaken is for martinis!) Look, I know you mean well, BNW, but I'm not sure you're helping.
A large amount of shaken quartzAre you trying to say "shocked" quartz? (Shaken is for martinis!) Look, I know you mean well, BNW, but I'm not sure you're helping.
Right. Because the entire value of my contribution to the conversation can be summed up in how well I get the nit picking details of the terminology right at 1 am. Oh, if only sciences terminology were more precise, THEN it would be believed!
"Every religion is true one way or another. It is true when understood metaphorically. But when it gets stuck in its own metaphors, interpreting them as facts, then you are in trouble." - Joseph Campbell
Right. Because the entire value of my contribution to the conversation can be summed up in how well I get the nit picking details of the terminology right at 1 am.
Given there's a precedent for getting on people's cases for using meaningless terms like "evolutionists" and "macroevolution," it seemed only fair to hold everyone to the same standard.
Right. Because the entire value of my contribution to the conversation can be summed up in how well I get the nit picking details of the terminology right at 1 am.Given there's a precedent for getting on people's cases for using meaningless terms like "evolutionists" and "macroevolution," it seemed only fair to hold everyone to the same standard.
And if you'd stopped your post after the martini comment i would have laughed and made a bad Bond. Tetrahedral bond comment. As it is your post is needlessly condescending.
Terms like macro evolution and evolutionist are deliberately misleading ( see the wedge strategy Shaken vs shocked quartz was just a brain fart.
And if you'd stopped your post after the martini comment i would have laughed and made a bad Bond. Tetrahedral bond comment.
Damn it! I miss all the best jokes that way. Since these are the Paizo boards, though, I do have to question why Bond needs his drinks to take a -2 penalty to attacks, saves, and checks.
And if you'd stopped your post after the martini comment i would have laughed and made a bad Bond. Tetrahedral bond comment.Damn it! I miss all the best jokes that way. Since these are the Paizo boards, though, I do have to question why Bond needs his drinks to take a -2 penalty to attacks, saves, and checks.
Liquid Courage(Ex): +2 morale bonus to attacks, saves, and skill checks when holding a drink in your hand.
They off-set!
Porting in from a thread that derailed waaaay back
B) You're using the Old Testament for the infidel-killing stuff for Christianity. That doesn't theologically fly, sorry.
According to who's theology? Yours?
See, here's the thing. I'm an atheist. I don't believe in theological truths because to me that's an oxymoron. Even if god were to exist there's no way to know what it would want.
As I said, Christianity recently decided that killing massive numbers of people for not praying at the same altar that you do is wrong. Before that they had no problem with it. For most of Christianity's history killing off people that disagreed with their theology was standard operating procedure. See crusades, cathar/Albigensian crusades, the inquisition, the papal states...
They did this, largely, by ignoring the old testament. If you want to consider theology as the interpretation of the bible i think this is problematic on a few fronts.
First of all, Jesus does not spend a lot of time talking about god. He talked about him being the way to god, but since his audience was Jewish he really didn't spend a lot of time explaining exactly who people were supposed to be getting to through him. That leaves the old testament (and whatever stories jesus was referencing that didn't make it into the bible) for explaining the nature of the deity jesus wanted to talk about.
Secondly, once you put the book together and say "this is what god wants" its a little odd to then effectively ignore half of it (until someone needs to come up with an argument against homosexuality)
I'm not saying that the Church has not committed its errors in the past, it most certainly has. And it recognizes the errors it has made, time and time again, although no one listens to it because they'd rather continue using things like the Crusades and the Inquisition as their ammunition.
Which church? The catholic church only started behaving once it was no longer in a position to do anything wrong. And even then...
B) You're using the Old Testament for the infidel-killing stuff for Christianity. That doesn't theologically fly, sorry.
Theologically it does fly.
The Old Testament is the foundation of the New Testament. There are passages spread throughout that foretell the coming of the Messiah, these passages are used as proof in the gospels that Jesus is the son of God.
Here's a page that goes into some of the specifics.
The 10 Commandments are often referred to, as is Genesis, Exodus, Proverbs and the Psalms. In fact, if you look at patterns in American history, you will see that Exodus has a greater impact on American culture and history than any other book in the Bible.
If the Bible is the Word, the Word is with God, the Word is God... then you can't pick and choose which parts to believe in.
|
|
If the Bible is the Word, the Word is with God, the Word is God... then you can't pick and choose which parts to believe in.
To say that they can't do it ignores the very real fact that they do it and always have. In fact, to pick and choose is an essential part of the faith.
Do you mean it's an (seemingly) essential part of the general practice of Christianity, or that the Christian faith requires it? Please explain.